Orthologous regulated operons containing nigD gene
Regulog: | NigR - Lactobacillaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Nigerose utilization |
Effector: | Nigerose-6-phosphate |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Lactobacillus johnsonii NCC 533 | ||||
Position: -101
Score: 6.85964 Sequence: AACTTAAAACGTTTCAAGTT
Position: -35
Score: 5.0237 Sequence: TATTTAAAACGTTTAGATTT
Locus tag: LJ0739
Name: nigB Funciton: Nigerose-specific PTS system, EIIB component
Locus tag: LJ0740
Name: nigC Funciton: Nigerose-specific PTS system, EIIC component
Locus tag: LJ0741
Name: nigD Funciton: Nigerose-specific PTS system, EIID component
Locus tag: LJ0742
Name: nigA Funciton: Nigerose-specific PTS system, EIIA component
Locus tag: LJ0743
Name: ogl Funciton: Cytoplasmic oligo-1,6-glucosidase (EC 3.2.1.10), family 13 of glycosyl hydrolase
Locus tag: LJ0744
Name: nigR Funciton: Nigerose utilization repressor, LacI family |
||||
nigB-nigC-nigD-nigA-ogl-nigR | -101 | 6.9 | AACTTAAAACGTTTCAAGTT | LJ0739 |
-35 | 5 | TATTTAAAACGTTTAGATTT | ||
Lactobacillus salivarius subsp. salivarius UCC118 | ||||
Position: -86
Score: 6.9577 Sequence: AACTTGAAACGTTTAAAGTT
Locus tag: LSL_1716
Name: nigB Funciton: Nigerose-specific PTS system, EIIB component
Locus tag: LSL_1715
Name: nigC Funciton: Nigerose-specific PTS system, EIIC component
Locus tag: LSL_1714
Name: nigD Funciton: Nigerose-specific PTS system, EIID component
Locus tag: LSL_1713
Name: nigA Funciton: Nigerose-specific PTS system, EIIA component
Locus tag: LSL_1712
Name: ogl Funciton: Cytoplasmic oligo-1,6-glucosidase (EC 3.2.1.10), family 13 of glycosyl hydrolase
Locus tag: LSL_1711
Name: nigR Funciton: Nigerose utilization repressor, LacI family |
||||
nigB-nigC-nigD-nigA-ogl-nigR | -86 | 7 | AACTTGAAACGTTTAAAGTT | LSL_1716 |