Orthologous regulated operons containing nigC gene

Properties
Regulog:	NigR - Lactobacillaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Nigerose utilization
Effector:	Nigerose-6-phosphate
Phylum:	Firmicutes

Built upon 5 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Lactobacillus johnsonii NCC 533
Position: -101 Score: 6.85964 Sequence: AACTTAAAACGTTTCAAGTT Position: -35 Score: 5.0237 Sequence: TATTTAAAACGTTTAGATTT Locus tag: LJ0739 Name: nigB Funciton: Nigerose-specific PTS system, EIIB component Locus tag: LJ0740 Name: nigC Funciton: Nigerose-specific PTS system, EIIC component Locus tag: LJ0741 Name: nigD Funciton: Nigerose-specific PTS system, EIID component Locus tag: LJ0742 Name: nigA Funciton: Nigerose-specific PTS system, EIIA component Locus tag: LJ0743 Name: ogl Funciton: Cytoplasmic oligo-1,6-glucosidase (EC 3.2.1.10), family 13 of glycosyl hydrolase Locus tag: LJ0744 Name: nigR Funciton: Nigerose utilization repressor, LacI family
nigB-nigC-nigD-nigA-ogl-nigR	-101	6.9	AACTTAAAACGTTTCAAGTT	LJ0739
	-35	5	TATTTAAAACGTTTAGATTT
Lactobacillus salivarius subsp. salivarius UCC118
Position: -86 Score: 6.9577 Sequence: AACTTGAAACGTTTAAAGTT Locus tag: LSL_1716 Name: nigB Funciton: Nigerose-specific PTS system, EIIB component Locus tag: LSL_1715 Name: nigC Funciton: Nigerose-specific PTS system, EIIC component Locus tag: LSL_1714 Name: nigD Funciton: Nigerose-specific PTS system, EIID component Locus tag: LSL_1713 Name: nigA Funciton: Nigerose-specific PTS system, EIIA component Locus tag: LSL_1712 Name: ogl Funciton: Cytoplasmic oligo-1,6-glucosidase (EC 3.2.1.10), family 13 of glycosyl hydrolase Locus tag: LSL_1711 Name: nigR Funciton: Nigerose utilization repressor, LacI family
nigB-nigC-nigD-nigA-ogl-nigR	-86	7	AACTTGAAACGTTTAAAGTT	LSL_1716