Orthologous regulated operons containing PF07944 gene
Regulog: | BL0176 - Bifidobacteriaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | |
Biological process: | Carbohydrate metabolism |
Effector: | |
Phylum: | Actinobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Bifidobacterium longum NCC2705 | ||||
Position: -55
Score: 6.1587 Sequence: CATATGTGCCGATACATATT
Locus tag: BL0174
Name: PF07944 Funciton: Putative glycosyl hydrolase of unknown function, DUF1680 |
||||
PF07944 | -55 | 6.2 | CATATGTGCCGATACATATT | BL0174 |