Orthologous regulated operons containing xynD gene
Regulog: | BL0176 - Bifidobacteriaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | |
Biological process: | Carbohydrate metabolism |
Effector: | |
Phylum: | Actinobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Bifidobacterium adolescentis ATCC 15703 | ||||
Position: -148
Score: 6.53414 Sequence: TATATGTATCGTTACATATA
Locus tag: BAD_1526
Name: null Funciton: Transcriptional regulator, LacI family
Locus tag: BAD_1527
Name: xynD Funciton: Endo-1,4-beta-xylanase |
||||
BAD_1526-xynD | -148 | 6.5 | TATATGTATCGTTACATATA | BAD_1526 |
Bifidobacterium dentium Bd1 | ||||
Position: -175
Score: 6.77351 Sequence: TATATGTAACGGTACATATT
Locus tag: BDP_2093
Name: null Funciton: Transcriptional regulator, LacI family
Locus tag: BDP_2094
Name: xynD Funciton: Endo-1,4-beta-xylanase |
||||
BDP_2093-xynD | -175 | 6.8 | TATATGTAACGGTACATATT | BDP_2093 |