Orthologous regulated operons containing nagA gene
Regulog: | BL0176 - Bifidobacteriaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | |
Biological process: | Carbohydrate metabolism |
Effector: | |
Phylum: | Actinobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Bifidobacterium adolescentis ATCC 15703 | ||||
Position: -92
Score: 6.53414 Sequence: TATATGTAACGATACATATA
Locus tag: BAD_1525
Name: nagA Funciton: Alpha-N-acetylgalactosaminidase (EC 3.2.1.49)
Locus tag: BAD_1524
Name: abfA Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55) |
||||
nagA-abfA | -92 | 6.5 | TATATGTAACGATACATATA | BAD_1525 |
Bifidobacterium dentium Bd1 | ||||
Position: -157
Score: 6.77351 Sequence: AATATGTACCGTTACATATA
Locus tag: BDP_2092
Name: nagA Funciton: Alpha-N-acetylgalactosaminidase (EC 3.2.1.49)
Locus tag: BDP_2091
Name: abfA Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55) |
||||
nagA-abfA | -157 | 6.8 | AATATGTACCGTTACATATA | BDP_2092 |
Bifidobacterium longum NCC2705 | ||||
Position: -183
Score: 6.43625 Sequence: AATATGTAACGGTACATACG
Locus tag: BL0177
Name: nagA Funciton: Alpha-N-acetylgalactosaminidase (EC 3.2.1.49) |
||||
nagA | -183 | 6.4 | AATATGTAACGGTACATACG | BL0177 |