Orthologous regulated operons containing BIFBRE_02142 gene
| Regulog: | BDP_2111 - Bifidobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Carbohydrate metabolism |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bifidobacterium breve DSM 20213 | ||||
|
Position: -81
Score: 6.20787 Sequence: TTATCTTAACGATACGATAT
Locus tag: BIFBRE_02141
Name: BIFBRE_02141 Funciton: ABC-type transport system, substrate-binding component
Locus tag: BIFBRE_02142
Name: BIFBRE_02142 Funciton: ABC-type transport system, permease component
Locus tag: BIFBRE_02143
Name: BIFBRE_02143 Funciton: ABC-type transport system, permease component |
||||
| BIFBRE_02141-BIFBRE_02142-BIFBRE_02143 | -81 | 6.2 | TTATCTTAACGATACGATAT | BIFBRE_02141 |