Orthologous regulated operons containing bfrB gene

Properties
Regulog:	BfrR - Bifidobacteriaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:
Biological process:	Fructooligosaccharides utilization
Effector:
Phylum:	Actinobacteria

Built upon 6 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bifidobacterium adolescentis ATCC 15703
Position: -141 Score: 6.02227 Sequence: TGAGATAAACGATTAACGTT Position: -120 Score: 4.85406 Sequence: GACATTAAACGATTAACGAT Locus tag: BAD_1330 Name: bfrB Funciton: Putative fructooligosaccharide ABC transporter, substrate-binding component Locus tag: BAD_1329 Name: bfrC Funciton: Putative fructooligosaccharide ABC transporter, permease component 1 Locus tag: BAD_1328 Name: bfrD Funciton: Putative fructooligosaccharide ABC transporter, permease component 2 Locus tag: BAD_1327 Name: PF04854 Funciton: Predicted integral membrane protein, DUF624 Locus tag: BAD_1326 Name: bfrR Funciton: Putative transcriptional regulator of fructooligosaccharide utilization, LacI-family Locus tag: BAD_1325 Name: bfrA Funciton: Beta-fructosidase (EC 3.2.1.26)
bfrB-bfrC-bfrD-PF04854-bfrR-bfrA	-141	6	TGAGATAAACGATTAACGTT	BAD_1330
	-120	4.9	GACATTAAACGATTAACGAT
Bifidobacterium angulatum DSM 20098
Position: -140 Score: 5.63618 Sequence: TGGAATAATCGTTTAACGTT Position: -119 Score: 4.85406 Sequence: GACATTAAACGATTAACGAT Locus tag: BIFANG_00830 Name: bfrB Funciton: Putative fructooligosaccharide ABC transporter, substrate-binding component Locus tag: BIFANG_00831 Name: bfrC Funciton: Putative fructooligosaccharide ABC transporter, permease component 1 Locus tag: BIFANG_00832 Name: bfrD Funciton: Putative fructooligosaccharide ABC transporter, permease component 2 Locus tag: BIFANG_00833 Name: PF04854 Funciton: Predicted integral membrane protein, DUF624 Locus tag: BIFANG_00834 Name: bfrR Funciton: Putative transcriptional regulator of fructooligosaccharide utilization, LacI-family Locus tag: BIFANG_00835 Name: bfrA Funciton: Beta-fructosidase (EC 3.2.1.26)
bfrB-bfrC-bfrD-PF04854-bfrR-bfrA	-140	5.6	TGGAATAATCGTTTAACGTT	BIFANG_00830
	-119	4.9	GACATTAAACGATTAACGAT
Bifidobacterium longum subsp. infantis ATCC 15697
Position: -156 Score: 5.91169 Sequence: TGAGATAAACGATTAACATT Position: -135 Score: 4.85406 Sequence: GACATTAATCGATTAACGTC Locus tag: Blon_2061 Name: bfrB Funciton: Putative fructooligosaccharide ABC transporter, substrate-binding component Locus tag: Blon_2060 Name: bfrC Funciton: Putative fructooligosaccharide ABC transporter, permease component 1 Locus tag: Blon_2059 Name: bfrD Funciton: Putative fructooligosaccharide ABC transporter, permease component 2 Locus tag: Blon_2058 Name: PF04854 Funciton: Predicted integral membrane protein, DUF624 Locus tag: Blon_2057 Name: bfrR Funciton: Putative transcriptional regulator of fructooligosaccharide utilization, LacI-family Locus tag: Blon_2056 Name: bfrA Funciton: Beta-fructosidase (EC 3.2.1.26)
bfrB-bfrC-bfrD-PF04854-bfrR-bfrA	-156	5.9	TGAGATAAACGATTAACATT	Blon_2061
	-135	4.9	GACATTAATCGATTAACGTC