Orthologous regulated operons containing bfrB gene
| Regulog: | BfrR - Bifidobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Fructooligosaccharides utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bifidobacterium adolescentis ATCC 15703 | ||||
|
Position: -141
Score: 6.02227 Sequence: TGAGATAAACGATTAACGTT
Position: -120
Score: 4.85406 Sequence: GACATTAAACGATTAACGAT
Locus tag: BAD_1330
Name: bfrB Funciton: Putative fructooligosaccharide ABC transporter, substrate-binding component
Locus tag: BAD_1329
Name: bfrC Funciton: Putative fructooligosaccharide ABC transporter, permease component 1
Locus tag: BAD_1328
Name: bfrD Funciton: Putative fructooligosaccharide ABC transporter, permease component 2
Locus tag: BAD_1327
Name: PF04854 Funciton: Predicted integral membrane protein, DUF624
Locus tag: BAD_1326
Name: bfrR Funciton: Putative transcriptional regulator of fructooligosaccharide utilization, LacI-family
Locus tag: BAD_1325
Name: bfrA Funciton: Beta-fructosidase (EC 3.2.1.26) |
||||
| bfrB-bfrC-bfrD-PF04854-bfrR-bfrA | -141 | 6 | TGAGATAAACGATTAACGTT | BAD_1330 |
| -120 | 4.9 | GACATTAAACGATTAACGAT | ||
| Bifidobacterium angulatum DSM 20098 | ||||
|
Position: -140
Score: 5.63618 Sequence: TGGAATAATCGTTTAACGTT
Position: -119
Score: 4.85406 Sequence: GACATTAAACGATTAACGAT
Locus tag: BIFANG_00830
Name: bfrB Funciton: Putative fructooligosaccharide ABC transporter, substrate-binding component
Locus tag: BIFANG_00831
Name: bfrC Funciton: Putative fructooligosaccharide ABC transporter, permease component 1
Locus tag: BIFANG_00832
Name: bfrD Funciton: Putative fructooligosaccharide ABC transporter, permease component 2
Locus tag: BIFANG_00833
Name: PF04854 Funciton: Predicted integral membrane protein, DUF624
Locus tag: BIFANG_00834
Name: bfrR Funciton: Putative transcriptional regulator of fructooligosaccharide utilization, LacI-family
Locus tag: BIFANG_00835
Name: bfrA Funciton: Beta-fructosidase (EC 3.2.1.26) |
||||
| bfrB-bfrC-bfrD-PF04854-bfrR-bfrA | -140 | 5.6 | TGGAATAATCGTTTAACGTT | BIFANG_00830 |
| -119 | 4.9 | GACATTAAACGATTAACGAT | ||
| Bifidobacterium longum subsp. infantis ATCC 15697 | ||||
|
Position: -156
Score: 5.91169 Sequence: TGAGATAAACGATTAACATT
Position: -135
Score: 4.85406 Sequence: GACATTAATCGATTAACGTC
Locus tag: Blon_2061
Name: bfrB Funciton: Putative fructooligosaccharide ABC transporter, substrate-binding component
Locus tag: Blon_2060
Name: bfrC Funciton: Putative fructooligosaccharide ABC transporter, permease component 1
Locus tag: Blon_2059
Name: bfrD Funciton: Putative fructooligosaccharide ABC transporter, permease component 2
Locus tag: Blon_2058
Name: PF04854 Funciton: Predicted integral membrane protein, DUF624
Locus tag: Blon_2057
Name: bfrR Funciton: Putative transcriptional regulator of fructooligosaccharide utilization, LacI-family
Locus tag: Blon_2056
Name: bfrA Funciton: Beta-fructosidase (EC 3.2.1.26) |
||||
| bfrB-bfrC-bfrD-PF04854-bfrR-bfrA | -156 | 5.9 | TGAGATAAACGATTAACATT | Blon_2061 |
| -135 | 4.9 | GACATTAATCGATTAACGTC | ||