Orthologous regulated operons containing BL0185 gene
| Regulog: | BL0185 - Bifidobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Carbohydrate metabolism |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bifidobacterium angulatum DSM 20098 | ||||
|
Position: -69
Score: 5.96147 Sequence: GCTGTACAACGATGTAAAAA
Position: -43
Score: 4.9777 Sequence: ATAATACATCGATGTAAATC
Locus tag: BIFANG_01256
Name: null Funciton: Glycoside hydrolase, family 43
Locus tag: BIFANG_01257
Name: BL0185 Funciton: Transcriptional regulator of carbohydrate utilization, LacI family |
||||
| BIFANG_01256-BL0185 | -69 | 6 | GCTGTACAACGATGTAAAAA | BIFANG_01256 |
| -43 | 5 | ATAATACATCGATGTAAATC | ||
| Bifidobacterium dentium Bd1 | ||||
|
Position: -69
Score: 6.08395 Sequence: TTTGTACAACGTTGTAATAT
Position: -44
Score: 5.35762 Sequence: ATAGTACATCGTTGTAAATG
Locus tag: BDP_0237
Name: null Funciton: Glycoside hydrolase, family 43
Locus tag: BDP_0238
Name: BL0185 Funciton: Transcriptional regulator of carbohydrate utilization, LacI family |
||||
| BDP_0237-BL0185 | -69 | 6.1 | TTTGTACAACGTTGTAATAT | BDP_0237 |
| -44 | 5.4 | ATAGTACATCGTTGTAAATG | ||
| Bifidobacterium longum NCC2705 | ||||
|
Position: -73
Score: 5.97869 Sequence: TTTGTACAACGATGTAAACT
Locus tag: BL0184
Name: null Funciton: Glycoside hydrolase, family 43
Locus tag: BL0185
Name: BL0185 Funciton: Transcriptional regulator of carbohydrate utilization, LacI family |
||||
| BL0184-BL0185 | -73 | 6 | TTTGTACAACGATGTAAACT | BL0184 |