Orthologous regulated operons containing bglS gene
| Regulog: | BL0185 - Bifidobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Carbohydrate metabolism |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bifidobacterium adolescentis ATCC 15703 | ||||
|
Position: -299
Score: 5.83463 Sequence: GTTGTACAACGATAGAAAAA
Position: -267
Score: 4.69328 Sequence: AAATTACAACGTTGAAAATA
Locus tag: BAD_0153
Name: null Funciton: ABC-type sugar transport systems, substrate-binding components
Locus tag: BAD_0154
Name: null Funciton: ABC-type sugar transport systems, permease components
Locus tag: BAD_0155
Name: null Funciton: ABC-type sugar transport systems, permease components
Locus tag: BAD_0156
Name: bglS Funciton: Beta-glucosidase (EC 3.2.1.21) |
||||
| BAD_0153-BAD_0154-BAD_0155-bglS | -299 | 5.8 | GTTGTACAACGATAGAAAAA | BAD_0153 |
| -267 | 4.7 | AAATTACAACGTTGAAAATA | ||