Orthologous regulated operons containing BDP_0243 gene
Regulog: | BL0185 - Bifidobacteriaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | |
Biological process: | Carbohydrate metabolism |
Effector: | |
Phylum: | Actinobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Bifidobacterium dentium Bd1 | ||||
Position: -170
Score: 5.94134 Sequence: TTTGTACAACGATAGAAAAA
Locus tag: BDP_0240
Name: null Funciton: ABC-type sugar transporter, sugar-binding component
Locus tag: BDP_0241
Name: null Funciton: ABC-type sugar transporter, permease component
Locus tag: BDP_0242
Name: null Funciton: ABC-type sugar transporter, permease component
Locus tag: BDP_0243
Name: null Funciton: Glycosyl hydrolase family 43 |
||||
BDP_0240-BDP_0241-BDP_0242-BDP_0243 | -170 | 5.9 | TTTGTACAACGATAGAAAAA | BDP_0240 |