Orthologous regulated operons containing Blon_2061 gene
| Regulog: | BL0185 - Bifidobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Carbohydrate metabolism |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bifidobacterium dentium Bd1 | ||||
|
Position: -170
Score: 5.94134 Sequence: TTTGTACAACGATAGAAAAA
Locus tag: BDP_0240
Name: null Funciton: ABC-type sugar transporter, sugar-binding component
Locus tag: BDP_0241
Name: null Funciton: ABC-type sugar transporter, permease component
Locus tag: BDP_0242
Name: null Funciton: ABC-type sugar transporter, permease component
Locus tag: BDP_0243
Name: null Funciton: Glycosyl hydrolase family 43 |
||||
| BDP_0240-BDP_0241-BDP_0242-BDP_0243 | -170 | 5.9 | TTTGTACAACGATAGAAAAA | BDP_0240 |