Orthologous regulated operons containing BL0182 gene
| Regulog: | BL0185 - Bifidobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Carbohydrate metabolism |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bifidobacterium longum NCC2705 | ||||
|
Position: -62
Score: 5.97869 Sequence: AGTTTACATCGTTGTACAAA
Locus tag: BL0183
Name: null Funciton: Glycoside hydrolase, family 43
Locus tag: BL0182
Name: null Funciton: Glycoside hydrolase, family 43 |
||||
| BL0183-BL0182 | -62 | 6 | AGTTTACATCGTTGTACAAA | BL0183 |