Orthologous regulated operons containing BIFANG_01261 gene
Regulog: | BL0185 - Bifidobacteriaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | |
Biological process: | Carbohydrate metabolism |
Effector: | |
Phylum: | Actinobacteria |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Bifidobacterium angulatum DSM 20098 | ||||
Position: -146
Score: 5.68366 Sequence: CTTGTACAACGATAGAAAAA
Position: -114
Score: 5.11564 Sequence: AAATTACAACGTTATAAAAG
Locus tag: BIFANG_01259
Name: null Funciton: ABC transporter, substrate-binding protein
Locus tag: BIFANG_01260
Name: null Funciton: ABC-type sugar transporter, permease component
Locus tag: BIFANG_01261
Name: null Funciton: ABC-type sugar transporter, permease component |
||||
BIFANG_01259-BIFANG_01260-BIFANG_01261 | -146 | 5.7 | CTTGTACAACGATAGAAAAA | BIFANG_01259 |
-114 | 5.1 | AAATTACAACGTTATAAAAG |