Orthologous regulated operons containing BL0186 gene
| Regulog: | BL0185 - Bifidobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Carbohydrate metabolism |
| Effector: | |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bifidobacterium longum NCC2705 | ||||
|
Position: -231
Score: 5.00276 Sequence: TATTTACATCGATGCAATAT
Position: -207
Score: 5.54588 Sequence: GATGTACAACGATGTAACAA
Position: -65
Score: 4.72962 Sequence: GAATTACAACGTTATAATGA
Locus tag: BL0186
Name: null Funciton: possible esterase |
||||
| BL0186 | -231 | 5 | TATTTACATCGATGCAATAT | BL0186 |
| -207 | 5.5 | GATGTACAACGATGTAACAA | ||
| -65 | 4.7 | GAATTACAACGTTATAATGA | ||