Orthologous regulated operons containing manD gene

Properties
Regulog:	ManR - Thermotogales
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Mannan and beta-mannosides utilization
Effector:	Mannose
Phylum:	Thermotogae

Built upon 9 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Thermotoga maritima MSB8
Position: -38 Score: 7.45403 Sequence: AAATAAGTAAAGTTTACTAATTA Locus tag: TM1227 Name: manB Funciton: Endo-1,4-beta-mannosidase Locus tag: TM1226 Name: manD Funciton: Mannoside ABC transport system, sugar-binding protein Locus tag: TM1225 Name: manC Funciton: Predicted mannobiose phosphorylase Locus tag: TM1224 Name: manR Funciton: Mannose-responsive regulator of mannose and mannoside utilization, ROK family
manB-manD-manC-manR	-38	7.5	AAATAAGTAAAGTTTACTAATTA	TM1227
Thermotoga naphthophila RKU-10
Position: -38 Score: 7.45403 Sequence: AAATAAGTAAAGTTTACTAATTA Locus tag: Tnap_1565 Name: manB Funciton: Endo-1,4-beta-mannosidase Locus tag: Tnap_1566 Name: manD Funciton: Mannoside ABC transport system, sugar-binding protein Locus tag: Tnap_1567 Name: manC Funciton: Predicted mannobiose phosphorylase Locus tag: Tnap_1568 Name: manR Funciton: Mannose-responsive regulator of mannose and mannoside utilization, ROK family
manB-manD-manC-manR	-38	7.5	AAATAAGTAAAGTTTACTAATTA	Tnap_1565
Thermotoga sp. RQ2
Position: -38 Score: 7.45403 Sequence: AAATAAGTAAAGTTTACTAATTA Locus tag: TRQ2_1591 Name: manB Funciton: Endo-1,4-beta-mannosidase Locus tag: TRQ2_1592 Name: manD Funciton: Mannoside ABC transport system, sugar-binding protein Locus tag: TRQ2_1593 Name: manC Funciton: Predicted mannobiose phosphorylase Locus tag: TRQ2_1594 Name: manR Funciton: Mannose-responsive regulator of mannose and mannoside utilization, ROK family
manB-manD-manC-manR	-38	7.5	AAATAAGTAAAGTTTACTAATTA	TRQ2_1591