Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing manB gene

Properties
Regulog: ManR - Thermotogales
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Mannan and beta-mannosides utilization
Effector: Mannose
Phylum: Thermotogae
Built upon 9 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Thermotoga maritima MSB8
Position: -38
Score: 7.45403
Sequence: AAATAAGTAAAGTTTACTAATTA
Locus tag: TM1227
Name: manB
Funciton: Endo-1,4-beta-mannosidase
Locus tag: TM1226
Name: manD
Funciton: Mannoside ABC transport system, sugar-binding protein
Locus tag: TM1225
Name: manC
Funciton: Predicted mannobiose phosphorylase
Locus tag: TM1224
Name: manR
Funciton: Mannose-responsive regulator of mannose and mannoside utilization, ROK family
manB-manD-manC-manR -38 7.5 AAATAAGTAAAGTTTACTAATTA TM1227
Thermotoga naphthophila RKU-10
Position: -38
Score: 7.45403
Sequence: AAATAAGTAAAGTTTACTAATTA
Locus tag: Tnap_1565
Name: manB
Funciton: Endo-1,4-beta-mannosidase
Locus tag: Tnap_1566
Name: manD
Funciton: Mannoside ABC transport system, sugar-binding protein
Locus tag: Tnap_1567
Name: manC
Funciton: Predicted mannobiose phosphorylase
Locus tag: Tnap_1568
Name: manR
Funciton: Mannose-responsive regulator of mannose and mannoside utilization, ROK family
manB-manD-manC-manR -38 7.5 AAATAAGTAAAGTTTACTAATTA Tnap_1565
Thermotoga neapolitana DSM 4359
Position: -38
Score: 6.90233
Sequence: AAATAAGTACAGATTACTAATTA
Locus tag: CTN_1345
Name: manB
Funciton: Endo-1,4-beta-mannosidase
Locus tag: CTN_1346
Name: manC
Funciton: Predicted mannobiose phosphorylase
Locus tag: CTN_1347
Name: manR
Funciton: Mannose-responsive regulator of mannose and mannoside utilization, ROK family
manB-manC-manR -38 6.9 AAATAAGTACAGATTACTAATTA CTN_1345
Thermotoga petrophila RKU-1
Position: -38
Score: 7.45403
Sequence: AAATAAGTAAAGTTTACTAATTA
Locus tag: Tpet_1542
Name: manB
Funciton: Endo-1,4-beta-mannosidase
Locus tag: Tpet_1543
Name: manC
Funciton: Predicted mannobiose phosphorylase
Locus tag: Tpet_1544
Name: manR
Funciton: Mannose-responsive regulator of mannose and mannoside utilization, ROK family
manB-manC-manR -38 7.5 AAATAAGTAAAGTTTACTAATTA Tpet_1542
Thermotoga sp. RQ2
Position: -38
Score: 7.45403
Sequence: AAATAAGTAAAGTTTACTAATTA
Locus tag: TRQ2_1591
Name: manB
Funciton: Endo-1,4-beta-mannosidase
Locus tag: TRQ2_1592
Name: manD
Funciton: Mannoside ABC transport system, sugar-binding protein
Locus tag: TRQ2_1593
Name: manC
Funciton: Predicted mannobiose phosphorylase
Locus tag: TRQ2_1594
Name: manR
Funciton: Mannose-responsive regulator of mannose and mannoside utilization, ROK family
manB-manD-manC-manR -38 7.5 AAATAAGTAAAGTTTACTAATTA TRQ2_1591