Orthologous regulated operons containing lamA gene
Regulog: | BglR - Thermotogales |
Regulator type: | Transcription factor |
Regulator family: | ROK |
Regulation mode: | repressor |
Biological process: | Beta-glucosides utilization |
Effector: | Cellobiose |
Phylum: | Thermotogae |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Thermotoga maritima MSB8 | ||||
Position: -45
Score: 6.78518 Sequence: AATTTCTTTCTGAGGAAGATAGA
Locus tag: TM0032
Name: bglR Funciton: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family
Locus tag: TM0031
Name: bglE Funciton: Beta-glucoside ABC transport system, sugar-binding protein
Locus tag: TM0030
Name: bglF Funciton: Beta-glucoside ABC transport system, permease protein 1
Locus tag: TM0029
Name: bglG Funciton: Beta-glucoside ABC transport system, permease protein 2
Locus tag: TM0028
Name: bglK Funciton: Beta-glucoside ABC transport system, ATP-binding protein 1
Locus tag: TM0027
Name: bglL Funciton: Beta-glucoside ABC transport system, ATP-binding protein 2
Locus tag: TM0026
Name: TM0026 Funciton: Hypothetical protein TM0026, BglR regulon
Locus tag: TM0025
Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21)
Locus tag: TM0024
Name: lamA Funciton: Laminarinase (EC 3.2.1.39) |
||||
bglR-bglE-bglF-bglG-bglK-bglL-TM0026-bglB-lamA | -45 | 6.8 | AATTTCTTTCTGAGGAAGATAGA | TM0032 |
Thermotoga naphthophila RKU-10 | ||||
Position: -45
Score: 6.78518 Sequence: AATTTCTTTCTGAGGAAGATAGA
Locus tag: Tnap_0663
Name: bglR Funciton: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family
Locus tag: Tnap_0662
Name: bglE Funciton: Beta-glucoside ABC transport system, sugar-binding protein
Locus tag: Tnap_0661
Name: bglF Funciton: Beta-glucoside ABC transport system, permease protein 1
Locus tag: Tnap_0660
Name: bglG Funciton: Beta-glucoside ABC transport system, permease protein 2
Locus tag: Tnap_0659
Name: bglK Funciton: Beta-glucoside ABC transport system, ATP-binding protein 1
Locus tag: Tnap_0658
Name: bglL Funciton: Beta-glucoside ABC transport system, ATP-binding protein 2
Locus tag: Tnap_0657
Name: TM0026 Funciton: Hypothetical protein TM0026, BglR regulon
Locus tag: Tnap_0656
Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21)
Locus tag: Tnap_0655
Name: lamA Funciton: Laminarinase (EC 3.2.1.39) |
||||
bglR-bglE-bglF-bglG-bglK-bglL-TM0026-bglB-lamA | -45 | 6.8 | AATTTCTTTCTGAGGAAGATAGA | Tnap_0663 |
Thermotoga neapolitana DSM 4359 | ||||
Position: -49
Score: 6.45303 Sequence: AATTCCTTTCTGAGGAAGATAAT
Locus tag: CTN_0660
Name: bglX Funciton: Predicted beta-glucoside-regulated ABC transport system, sugar binding component, COG1653
Locus tag: CTN_0661
Name: bglY Funciton: Predicted beta-glucoside-regulated ABC transport system, permease component 1, COG1175
Locus tag: CTN_0662
Name: bglZ Funciton: Predicted beta-glucoside-regulated ABC transport system, permease component 2, COG0395
Locus tag: CTN_0663
Name: bglR Funciton: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family
Locus tag: CTN_0664
Name: bglE Funciton: Beta-glucoside ABC transport system, sugar-binding protein
Locus tag: CTN_0665
Name: bglF Funciton: Beta-glucoside ABC transport system, permease protein 1
Locus tag: CTN_0666
Name: bglG Funciton: Beta-glucoside ABC transport system, permease protein 2
Locus tag: CTN_0667
Name: bglK Funciton: Beta-glucoside ABC transport system, ATP-binding protein 1
Locus tag: CTN_0668
Name: bglL Funciton: Beta-glucoside ABC transport system, ATP-binding protein 2
Locus tag: CTN_0669
Name: TM0026 Funciton: Hypothetical protein TM0026, BglR regulon
Locus tag: CTN_0670
Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21)
Locus tag: CTN_0671
Name: lamA Funciton: Laminarinase (EC 3.2.1.39) |
||||
bglX-bglY-bglZ-bglR-bglE-bglF-bglG-bglK-bglL-TM0026-bglB-lamA | -49 | 6.5 | AATTCCTTTCTGAGGAAGATAAT | CTN_0660 |
Thermotoga petrophila RKU-1 | ||||
Position: 29
Score: 6.78518 Sequence: AATtTCTTTCTGAGgAAGATAga
Locus tag: Tpet_0891
Name: bglR Funciton: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family
Locus tag: Tpet_0892
Name: bglE Funciton: Beta-glucoside ABC transport system, sugar-binding protein
Locus tag: Tpet_0893
Name: bglF Funciton: Beta-glucoside ABC transport system, permease protein 1
Locus tag: Tpet_0894
Name: bglG Funciton: Beta-glucoside ABC transport system, permease protein 2
Locus tag: Tpet_0895
Name: bglK Funciton: Beta-glucoside ABC transport system, ATP-binding protein 1
Locus tag: Tpet_0896
Name: bglL Funciton: Beta-glucoside ABC transport system, ATP-binding protein 2
Locus tag: Tpet_0897
Name: TM0026 Funciton: Hypothetical protein TM0026, BglR regulon
Locus tag: Tpet_0898
Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21)
Locus tag: Tpet_0899
Name: lamA Funciton: Laminarinase (EC 3.2.1.39) |
||||
bglR-bglE-bglF-bglG-bglK-bglL-TM0026-bglB-lamA | 29 | 6.8 | AATtTCTTTCTGAGgAAGATAga | Tpet_0891 |
Thermotoga sp. RQ2 | ||||
Position: -45
Score: 6.78518 Sequence: AATTTCTTTCTGAGGAAGATAGA
Locus tag: TRQ2_0913
Name: bglR Funciton: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family
Locus tag: TRQ2_0914
Name: bglE Funciton: Beta-glucoside ABC transport system, sugar-binding protein
Locus tag: TRQ2_0915
Name: bglF Funciton: Beta-glucoside ABC transport system, permease protein 1
Locus tag: TRQ2_0916
Name: bglG Funciton: Beta-glucoside ABC transport system, permease protein 2
Locus tag: TRQ2_0917
Name: bglK Funciton: Beta-glucoside ABC transport system, ATP-binding protein 1
Locus tag: TRQ2_0918
Name: bglL Funciton: Beta-glucoside ABC transport system, ATP-binding protein 2
Locus tag: TRQ2_0919
Name: TM0026 Funciton: Hypothetical protein TM0026, BglR regulon
Locus tag: TRQ2_0920
Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21)
Locus tag: TRQ2_0921
Name: lamA Funciton: Laminarinase (EC 3.2.1.39) |
||||
bglR-bglE-bglF-bglG-bglK-bglL-TM0026-bglB-lamA | -45 | 6.8 | AATTTCTTTCTGAGGAAGATAGA | TRQ2_0913 |