Orthologous regulated operons containing bglF gene

Properties
Regulog:	BglR - Thermotogales
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Cellobiose
Phylum:	Thermotogae

Built upon 7 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Thermotoga maritima MSB8
Position: -45 Score: 6.78518 Sequence: AATTTCTTTCTGAGGAAGATAGA Locus tag: TM0032 Name: bglR Funciton: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family Locus tag: TM0031 Name: bglE Funciton: Beta-glucoside ABC transport system, sugar-binding protein Locus tag: TM0030 Name: bglF Funciton: Beta-glucoside ABC transport system, permease protein 1 Locus tag: TM0029 Name: bglG Funciton: Beta-glucoside ABC transport system, permease protein 2 Locus tag: TM0028 Name: bglK Funciton: Beta-glucoside ABC transport system, ATP-binding protein 1 Locus tag: TM0027 Name: bglL Funciton: Beta-glucoside ABC transport system, ATP-binding protein 2 Locus tag: TM0026 Name: TM0026 Funciton: Hypothetical protein TM0026, BglR regulon Locus tag: TM0025 Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21) Locus tag: TM0024 Name: lamA Funciton: Laminarinase (EC 3.2.1.39)
bglR-bglE-bglF-bglG-bglK-bglL-TM0026-bglB-lamA	-45	6.8	AATTTCTTTCTGAGGAAGATAGA	TM0032
Thermotoga naphthophila RKU-10
Position: -45 Score: 6.78518 Sequence: AATTTCTTTCTGAGGAAGATAGA Locus tag: Tnap_0663 Name: bglR Funciton: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family Locus tag: Tnap_0662 Name: bglE Funciton: Beta-glucoside ABC transport system, sugar-binding protein Locus tag: Tnap_0661 Name: bglF Funciton: Beta-glucoside ABC transport system, permease protein 1 Locus tag: Tnap_0660 Name: bglG Funciton: Beta-glucoside ABC transport system, permease protein 2 Locus tag: Tnap_0659 Name: bglK Funciton: Beta-glucoside ABC transport system, ATP-binding protein 1 Locus tag: Tnap_0658 Name: bglL Funciton: Beta-glucoside ABC transport system, ATP-binding protein 2 Locus tag: Tnap_0657 Name: TM0026 Funciton: Hypothetical protein TM0026, BglR regulon Locus tag: Tnap_0656 Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21) Locus tag: Tnap_0655 Name: lamA Funciton: Laminarinase (EC 3.2.1.39)
bglR-bglE-bglF-bglG-bglK-bglL-TM0026-bglB-lamA	-45	6.8	AATTTCTTTCTGAGGAAGATAGA	Tnap_0663
Thermotoga neapolitana DSM 4359
Position: -49 Score: 6.45303 Sequence: AATTCCTTTCTGAGGAAGATAAT Locus tag: CTN_0660 Name: bglX Funciton: Predicted beta-glucoside-regulated ABC transport system, sugar binding component, COG1653 Locus tag: CTN_0661 Name: bglY Funciton: Predicted beta-glucoside-regulated ABC transport system, permease component 1, COG1175 Locus tag: CTN_0662 Name: bglZ Funciton: Predicted beta-glucoside-regulated ABC transport system, permease component 2, COG0395 Locus tag: CTN_0663 Name: bglR Funciton: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family Locus tag: CTN_0664 Name: bglE Funciton: Beta-glucoside ABC transport system, sugar-binding protein Locus tag: CTN_0665 Name: bglF Funciton: Beta-glucoside ABC transport system, permease protein 1 Locus tag: CTN_0666 Name: bglG Funciton: Beta-glucoside ABC transport system, permease protein 2 Locus tag: CTN_0667 Name: bglK Funciton: Beta-glucoside ABC transport system, ATP-binding protein 1 Locus tag: CTN_0668 Name: bglL Funciton: Beta-glucoside ABC transport system, ATP-binding protein 2 Locus tag: CTN_0669 Name: TM0026 Funciton: Hypothetical protein TM0026, BglR regulon Locus tag: CTN_0670 Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21) Locus tag: CTN_0671 Name: lamA Funciton: Laminarinase (EC 3.2.1.39)
bglX-bglY-bglZ-bglR-bglE-bglF-bglG-bglK-bglL-TM0026-bglB-lamA	-49	6.5	AATTCCTTTCTGAGGAAGATAAT	CTN_0660
Thermotoga petrophila RKU-1
Position: 29 Score: 6.78518 Sequence: AATtTCTTTCTGAGgAAGATAga Locus tag: Tpet_0891 Name: bglR Funciton: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family Locus tag: Tpet_0892 Name: bglE Funciton: Beta-glucoside ABC transport system, sugar-binding protein Locus tag: Tpet_0893 Name: bglF Funciton: Beta-glucoside ABC transport system, permease protein 1 Locus tag: Tpet_0894 Name: bglG Funciton: Beta-glucoside ABC transport system, permease protein 2 Locus tag: Tpet_0895 Name: bglK Funciton: Beta-glucoside ABC transport system, ATP-binding protein 1 Locus tag: Tpet_0896 Name: bglL Funciton: Beta-glucoside ABC transport system, ATP-binding protein 2 Locus tag: Tpet_0897 Name: TM0026 Funciton: Hypothetical protein TM0026, BglR regulon Locus tag: Tpet_0898 Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21) Locus tag: Tpet_0899 Name: lamA Funciton: Laminarinase (EC 3.2.1.39)
bglR-bglE-bglF-bglG-bglK-bglL-TM0026-bglB-lamA	29	6.8	AATtTCTTTCTGAGgAAGATAga	Tpet_0891
Thermotoga sp. RQ2
Position: -45 Score: 6.78518 Sequence: AATTTCTTTCTGAGGAAGATAGA Locus tag: TRQ2_0913 Name: bglR Funciton: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family Locus tag: TRQ2_0914 Name: bglE Funciton: Beta-glucoside ABC transport system, sugar-binding protein Locus tag: TRQ2_0915 Name: bglF Funciton: Beta-glucoside ABC transport system, permease protein 1 Locus tag: TRQ2_0916 Name: bglG Funciton: Beta-glucoside ABC transport system, permease protein 2 Locus tag: TRQ2_0917 Name: bglK Funciton: Beta-glucoside ABC transport system, ATP-binding protein 1 Locus tag: TRQ2_0918 Name: bglL Funciton: Beta-glucoside ABC transport system, ATP-binding protein 2 Locus tag: TRQ2_0919 Name: TM0026 Funciton: Hypothetical protein TM0026, BglR regulon Locus tag: TRQ2_0920 Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21) Locus tag: TRQ2_0921 Name: lamA Funciton: Laminarinase (EC 3.2.1.39)
bglR-bglE-bglF-bglG-bglK-bglL-TM0026-bglB-lamA	-45	6.8	AATTTCTTTCTGAGGAAGATAGA	TRQ2_0913