Orthologous regulated operons containing bglY gene
Regulog: | BglR - Thermotogales |
Regulator type: | Transcription factor |
Regulator family: | ROK |
Regulation mode: | repressor |
Biological process: | Beta-glucosides utilization |
Effector: | Cellobiose |
Phylum: | Thermotogae |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Thermotoga neapolitana DSM 4359 | ||||
Position: -49
Score: 6.45303 Sequence: AATTCCTTTCTGAGGAAGATAAT
Locus tag: CTN_0660
Name: bglX Funciton: Predicted beta-glucoside-regulated ABC transport system, sugar binding component, COG1653
Locus tag: CTN_0661
Name: bglY Funciton: Predicted beta-glucoside-regulated ABC transport system, permease component 1, COG1175
Locus tag: CTN_0662
Name: bglZ Funciton: Predicted beta-glucoside-regulated ABC transport system, permease component 2, COG0395
Locus tag: CTN_0663
Name: bglR Funciton: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family
Locus tag: CTN_0664
Name: bglE Funciton: Beta-glucoside ABC transport system, sugar-binding protein
Locus tag: CTN_0665
Name: bglF Funciton: Beta-glucoside ABC transport system, permease protein 1
Locus tag: CTN_0666
Name: bglG Funciton: Beta-glucoside ABC transport system, permease protein 2
Locus tag: CTN_0667
Name: bglK Funciton: Beta-glucoside ABC transport system, ATP-binding protein 1
Locus tag: CTN_0668
Name: bglL Funciton: Beta-glucoside ABC transport system, ATP-binding protein 2
Locus tag: CTN_0669
Name: TM0026 Funciton: Hypothetical protein TM0026, BglR regulon
Locus tag: CTN_0670
Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21)
Locus tag: CTN_0671
Name: lamA Funciton: Laminarinase (EC 3.2.1.39) |
||||
bglX-bglY-bglZ-bglR-bglE-bglF-bglG-bglK-bglL-TM0026-bglB-lamA | -49 | 6.5 | AATTCCTTTCTGAGGAAGATAAT | CTN_0660 |