Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing xynB gene

Properties
Regulog: XylR - Bacillales
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Xylose utilization
Effector: Xylose
Phylum: Firmicutes
Built upon 28 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacillus halodurans C-125
Position: -165
Score: 6.14666
Sequence: ACTTTGTTTAATGGTAAAACAAAGT
Locus tag: BH3678
Name: BH3678
Funciton: Two-component sensor histidine kinase
Locus tag: BH3679
Name: BH3679
Funciton: Two component transcriptional regulator, AraC family
Locus tag: BH3680
Name: BH3680
Funciton: Predicted beta-xyloside ABC transporter, substrate-binding component
Locus tag: BH3681
Name: BH3681
Funciton: Predicted beta-xyloside ABC transporter, permease component
Locus tag: BH3682
Name: BH3682
Funciton: Predicted beta-xyloside ABC transporter, ATP-binding component
Locus tag: BH3683
Name: xynB
Funciton: Beta-xylosidase (EC 3.2.1.37)
Locus tag: BH3684
Name: BH3684
Funciton: Putative permease
BH3678-BH3679-BH3680-BH3681-BH3682-xynB-BH3684 -165 6.1 ACTTTGTTTAATGGTAAAACAAAGT BH3678
© 2009-2020 RegPrecise