Orthologous regulated operons containing BH3678 gene
Regulog: | XylR - Bacillales |
Regulator type: | Transcription factor |
Regulator family: | ROK |
Regulation mode: | repressor |
Biological process: | Xylose utilization |
Effector: | Xylose |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Bacillus halodurans C-125 | ||||
Position: -165
Score: 6.14666 Sequence: ACTTTGTTTAATGGTAAAACAAAGT
Locus tag: BH3678
Name: BH3678 Funciton: Two-component sensor histidine kinase
Locus tag: BH3679
Name: BH3679 Funciton: Two component transcriptional regulator, AraC family
Locus tag: BH3680
Name: BH3680 Funciton: Predicted beta-xyloside ABC transporter, substrate-binding component
Locus tag: BH3681
Name: BH3681 Funciton: Predicted beta-xyloside ABC transporter, permease component
Locus tag: BH3682
Name: BH3682 Funciton: Predicted beta-xyloside ABC transporter, ATP-binding component
Locus tag: BH3683
Name: xynB Funciton: Beta-xylosidase (EC 3.2.1.37)
Locus tag: BH3684
Name: BH3684 Funciton: Putative permease |
||||
BH3678-BH3679-BH3680-BH3681-BH3682-xynB-BH3684 | -165 | 6.1 | ACTTTGTTTAATGGTAAAACAAAGT | BH3678 |