Orthologous regulated operons containing BLi03540 gene
| Regulog: | XylR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | ROK |
| Regulation mode: | repressor |
| Biological process: | Xylose utilization |
| Effector: | Xylose |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacillus licheniformis DSM 13 | ||||
|
Position: -52
Score: 5.95088 Sequence: ACTTAGTTTAGCTATTAAACTAACA
Locus tag: BLi03540
Name: null Funciton: Possible alpha-xyloside ABC transporter, substrate-binding component
Locus tag: BLi03541
Name: yurN Funciton: Possible alpha-xyloside ABC transporter, permease component
Locus tag: BLi03542
Name: yurM Funciton: Possible alpha-xyloside ABC transporter, permease component
Locus tag: BLi03543
Name: xylS Funciton: Alpha-glucosidase
Locus tag: BLi03544
Name: bglS Funciton: Beta-glucosidase (EC 3.2.1.21) |
||||
| BLi03540-yurN-yurM-xylS-bglS | -52 | 6 | ACTTAGTTTAGCTATTAAACTAACA | BLi03540 |