Orthologous regulated operons containing ywcJ gene
| Regulog: | Rex - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | Rex |
| Regulation mode: | repressor |
| Biological process: | Energy metabolism |
| Effector: | NADH |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Anoxybacillus flavithermus WK1 | ||||
|
Position: -43
Score: 4.89676 Sequence: AGTGTGAAAAACATCACAAA
Locus tag: Aflv_1436
Name: null Funciton: Nitrite transporter |
||||
| Aflv_1436 | -43 | 4.9 | AGTGTGAAAAACATCACAAA | Aflv_1436 |
| Bacillus cereus ATCC 14579 | ||||
|
Position: -103
Score: 6.11381 Sequence: TTTGTGAAACATTGCACAAA
Locus tag: BC1308
Name: null Funciton: Formate/nitrite family of transporters |
||||
| BC1308 | -103 | 6.1 | TTTGTGAAACATTGCACAAA | BC1308 |
| Bacillus licheniformis DSM 13 | ||||
|
Position: -89
Score: 6.20577 Sequence: TTTGTGAAATGTTTCACAAT
Locus tag: BLi04135
Name: ywcJ Funciton: Formate/nitrite family of transporters |
||||
| ywcJ | -89 | 6.2 | TTTGTGAAATGTTTCACAAT | BLi04135 |
| Bacillus subtilis subsp. subtilis str. 168 | ||||
|
Position: -66
Score: 6.36068 Sequence: ATTGTGAAATACTTCACAAT
Locus tag: BSU38060
Name: ywcJ Funciton: Formate/nitrite family of transporters |
||||
| ywcJ | -66 | 6.4 | ATTGTGAAATACTTCACAAT | BSU38060 |