Orthologous regulated operons containing yndJ gene
| Regulog: | Rex - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | Rex |
| Regulation mode: | repressor |
| Biological process: | Energy metabolism |
| Effector: | NADH |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacillus cereus ATCC 14579 | ||||
|
Position: -71
Score: 4.99187 Sequence: TTTGTGAAAAATGTAGCAAA
Locus tag: BC1749
Name: yndG Funciton: Hypothetical protein
Locus tag: BC1750
Name: yndH Funciton: Hypothetical protein
Locus tag: BC1751
Name: yndJ Funciton: Putative integral inner membrane protein |
||||
| yndG-yndH-yndJ | -71 | 5 | TTTGTGAAAAATGTAGCAAA | BC1749 |
| Bacillus licheniformis DSM 13 | ||||
|
Position: -32
Score: 5.82995 Sequence: ATTGTGAATATATTCACAAA
Locus tag: BLi02193
Name: yndG Funciton: Hypothetical protein
Locus tag: BLi02192
Name: yndH Funciton: Hypothetical protein
Locus tag: BLi02191
Name: yndJ Funciton: Putative integral inner membrane protein |
||||
| yndG-yndH-yndJ | -32 | 5.8 | ATTGTGAATATATTCACAAA | BLi02193 |
| Bacillus pumilus SAFR-032 | ||||
|
Position: -35
Score: 5.51794 Sequence: TATGTGAAACAATTCACATA
Locus tag: BPUM_1837
Name: yndG Funciton: Hypothetical protein
Locus tag: BPUM_1836
Name: yndH Funciton: Hypothetical protein
Locus tag: BPUM_1835
Name: yndJ Funciton: Putative integral inner membrane protein |
||||
| yndG-yndH-yndJ | -35 | 5.5 | TATGTGAAACAATTCACATA | BPUM_1837 |