Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing qoxB gene

Properties
Regulog: Rex - Bacillales
Regulator type: Transcription factor
Regulator family: Rex
Regulation mode: repressor
Biological process: Energy metabolism
Effector: NADH
Phylum: Firmicutes
Built upon 64 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Anoxybacillus flavithermus WK1
Position: -36
Score: 5.16939
Sequence: TTTGTTCAATGAATCACAAT
Locus tag: Aflv_0272
Name: qoxA
Funciton: Cytochrome aa3-600 quinol oxidase (subunit II) (EC 1.9.3.-)
Locus tag: Aflv_0273
Name: qoxB
Funciton: Cytochrome aa3-600 quinol oxidase (subunit I) (EC 1.9.3.-)
Locus tag: Aflv_0274
Name: qoxC
Funciton: Cytochrome aa3-600 quinol oxidase (subunit III) (EC 1.9.3.-)
Locus tag: Aflv_0275
Name: qoxD
Funciton: Cytochrome aa3-600 quinol oxidase (subunit IV) (EC 1.9.3.-)
qoxA-qoxB-qoxC-qoxD -36 5.2 TTTGTTCAATGAATCACAAT Aflv_0272
Oceanobacillus iheyensis HTE831
Position: -123
Score: 5.43368
Sequence: TTTGTGAAGCATTTCTCAAA
Locus tag: OB2253
Name: qoxA
Funciton: Cytochrome aa3-600 quinol oxidase (subunit II) (EC 1.9.3.-)
Locus tag: OB2254
Name: qoxB
Funciton: Cytochrome aa3-600 quinol oxidase (subunit I) (EC 1.9.3.-)
Locus tag: OB2255
Name: qoxC
Funciton: Cytochrome aa3-600 quinol oxidase (subunit III) (EC 1.9.3.-)
Locus tag: OB2256
Name: qoxD
Funciton: Cytochrome aa3-600 quinol oxidase (subunit IV) (EC 1.9.3.-)
qoxA-qoxB-qoxC-qoxD -123 5.4 TTTGTGAAGCATTTCTCAAA OB2253
© 2009-2020 RegPrecise