Orthologous regulated operons containing ytfE gene

Properties
Regulog:	HcpR - Thermotogales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Phylum:	Thermotogae

Built upon 20 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Thermosipho melanesiensis BI429
Position: -59 Score: 5.91973 Sequence: AGCGTAACATAAGTTACGGA Locus tag: Tmel_0755 Name: ytfE Funciton: Regulator of cell morphogenesis and NO signaling Locus tag: Tmel_0754 Name: hcp Funciton: Hydroxylamine reductase (EC 1.7.-.-)
ytfE-hcp	-59	5.9	AGCGTAACATAAGTTACGGA	Tmel_0755
Thermotogales bacterium TBF 19.5.1
Position: -86 Score: 6.56995 Sequence: TCCGTAACATATGTTACCGA Locus tag: Kole_1155 Name: ytfE Funciton: Regulator of cell morphogenesis and NO signaling Locus tag: Kole_1154 Name: hcp Funciton: Hydroxylamine reductase (EC 1.7.-.-)
ytfE-hcp	-86	6.6	TCCGTAACATATGTTACCGA	Kole_1155

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --