Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing rspB gene

Properties
Regulog: RspR - Rhodobacterales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: L-gulonate utilization
Effector: L-gulonate; D-mannonate
Phylum: Proteobacteria/Alpha
Built upon 3 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Paracoccus denitrificans PD1222
Position: -48
Score: 5.76587
Sequence: TTTACTAGTATGCAAGTATG
Locus tag: Pden_5067
Name: rspR
Funciton: Transcriptional regulator for L-gulonate utilization, GntR family
Locus tag: Pden_5066
Name: rspP
Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, periplasmic component
Locus tag: Pden_5065
Name: rspQ
Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, small permease component
Locus tag: Pden_5064
Name: rspM
Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, large permease component
Locus tag: Pden_5063
Name: rspB
Funciton: L-gulonate dehydrogenase, COG1063 family
Locus tag: Pden_5062
Name: COG1304
Funciton: L-lactate dehydrogenase (FMN-dependent) and related alpha-hydroxy acid dehydrogenases
Locus tag: Pden_5061
Name: uxuA
Funciton: Mannonate dehydratase (EC 4.2.1.8)
Locus tag: Pden_5060
Name: uxuB
Funciton: D-mannonate oxidoreductase (EC 1.1.1.57)
Locus tag: Pden_5059
Name: kdgK
Funciton: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
rspR-rspP-rspQ-rspM-rspB-COG1304-uxuA-uxuB-kdgK -48 5.8 TTTACTAGTATGCAAGTATG Pden_5067
© 2009-2020 RegPrecise