Orthologous regulated operons containing rspM gene

Properties
Regulog:	RspR - Rhodobacterales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	L-gulonate utilization
Effector:	L-gulonate; D-mannonate
Phylum:	Proteobacteria/Alpha

Built upon 3 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Paracoccus denitrificans PD1222
Position: -48 Score: 5.76587 Sequence: TTTACTAGTATGCAAGTATG Locus tag: Pden_5067 Name: rspR Funciton: Transcriptional regulator for L-gulonate utilization, GntR family Locus tag: Pden_5066 Name: rspP Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, periplasmic component Locus tag: Pden_5065 Name: rspQ Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, small permease component Locus tag: Pden_5064 Name: rspM Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, large permease component Locus tag: Pden_5063 Name: rspB Funciton: L-gulonate dehydrogenase, COG1063 family Locus tag: Pden_5062 Name: COG1304 Funciton: L-lactate dehydrogenase (FMN-dependent) and related alpha-hydroxy acid dehydrogenases Locus tag: Pden_5061 Name: uxuA Funciton: Mannonate dehydratase (EC 4.2.1.8) Locus tag: Pden_5060 Name: uxuB Funciton: D-mannonate oxidoreductase (EC 1.1.1.57) Locus tag: Pden_5059 Name: kdgK Funciton: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
rspR-rspP-rspQ-rspM-rspB-COG1304-uxuA-uxuB-kdgK	-48	5.8	TTTACTAGTATGCAAGTATG	Pden_5067
Silicibacter pomeroyi DSS-3
Position: -47 Score: 5.43738 Sequence: CCGACTAGTATGGAAGTATG Locus tag: SPO1722 Name: rspR Funciton: Transcriptional regulator for L-gulonate utilization, GntR family Locus tag: SPO1721 Name: rspP Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, periplasmic component Locus tag: SPO1720 Name: rspQ Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, small permease component Locus tag: SPO1719 Name: rspM Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, large permease component
rspR-rspP-rspQ-rspM	-47	5.4	CCGACTAGTATGGAAGTATG	SPO1722