Orthologous regulated operons containing ganQ gene

Properties
Regulog:	GanR - Bacillales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactan utilization
Effector:	Beta-galactosides
Phylum:	Firmicutes

Built upon 8 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bacillus clausii KSM-K16
Position: -108 Score: 7.16308 Sequence: TTAAGTAAAATATTTTACTAAA Locus tag: ABC3520 Name: ganO Funciton: Arabinogalactan oligomer ABC transporter, binding protein Locus tag: ABC3519 Name: ganP Funciton: Arabinogalactan oligomer ABC transporter, membrane protein Locus tag: ABC3518 Name: ganQ Funciton: Arabinogalactan oligomer ABC transporter, membrane protein Locus tag: ABC3517 Name: ganB Funciton: Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89) Locus tag: ABC3516 Name: ganA Funciton: Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase)
ganO-ganP-ganQ-ganB-ganA	-108	7.2	TTAAGTAAAATATTTTACTAAA	ABC3520
Bacillus halodurans C-125
Position: -127 Score: 5.90124 Sequence: TTTCCGAAAATATTTTACTCAT Locus tag: BH2019 Name: ganO Funciton: Arabinogalactan oligomer ABC transporter, binding protein Locus tag: BH2020 Name: ganP Funciton: Arabinogalactan oligomer ABC transporter, membrane protein Locus tag: BH2021 Name: ganQ Funciton: Arabinogalactan oligomer ABC transporter, membrane protein Locus tag: BH2022 Name: ganA Funciton: Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase) Locus tag: BH2023 Name: ganB Funciton: Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89)
ganO-ganP-ganQ-ganA-ganB	-127	5.9	TTTCCGAAAATATTTTACTCAT	BH2019
Bacillus licheniformis DSM 13
Position: -110 Score: 5.78815 Sequence: TTTCGTAAAACATTTTACCTGT Locus tag: BLi04280 Name: ganO Funciton: Arabinogalactan oligomer ABC transporter, binding protein Locus tag: BLi04279 Name: ganP Funciton: Arabinogalactan oligomer ABC transporter, membrane protein Locus tag: BLi04278 Name: ganQ Funciton: Arabinogalactan oligomer ABC transporter, membrane protein Locus tag: BLi04277 Name: ganA Funciton: Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase) Locus tag: BLi04276 Name: ganB Funciton: Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89)
ganO-ganP-ganQ-ganA-ganB	-110	5.8	TTTCGTAAAACATTTTACCTGT	BLi04280
Bacillus pumilus SAFR-032
Position: -126 Score: 6.79557 Sequence: TTGAGTAAAAAATTTTACTTAA Locus tag: BPUM_3613 Name: ganO Funciton: Arabinogalactan oligomer ABC transporter, binding protein Locus tag: BPUM_3614 Name: ganP Funciton: Arabinogalactan oligomer ABC transporter, membrane protein Locus tag: BPUM_3615 Name: ganQ Funciton: Arabinogalactan oligomer ABC transporter, membrane protein Locus tag: BPUM_3616 Name: ganB Funciton: Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89) Locus tag: BPUM_3617 Name: ganA Funciton: Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase)
ganO-ganP-ganQ-ganB-ganA	-126	6.8	TTGAGTAAAAAATTTTACTTAA	BPUM_3613
Bacillus subtilis subsp. subtilis str. 168
Position: -109 Score: 5.91324 Sequence: TTAGGTAAAAAAATTTACTCTA Locus tag: BSU34160 Name: ganO Funciton: Arabinogalactan oligomer ABC transporter, binding protein Locus tag: BSU34150 Name: ganP Funciton: Arabinogalactan oligomer ABC transporter, membrane protein Locus tag: BSU34140 Name: ganQ Funciton: Arabinogalactan oligomer ABC transporter, membrane protein Locus tag: BSU34130 Name: ganA Funciton: Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase) Locus tag: BSU34120 Name: ganB Funciton: Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89)
ganO-ganP-ganQ-ganA-ganB	-109	5.9	TTAGGTAAAAAAATTTACTCTA	BSU34160