Orthologous regulated operons containing PF00903 gene
Regulog: | SoxR - Sphingomonadales |
Regulator type: | Transcription factor |
Regulator family: | MerR |
Regulation mode: | activator (repressor) |
Biological process: | Superoxide stress response |
Effector: | Paraquat |
Phylum: | Proteobacteria/alpha |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Erythrobacter litoralis HTCC2594 | ||||
Position: -113
Score: 6.24898 Sequence: ACCTCAAGTCAGCTTGAGGT
Locus tag: ELI_02955
Name: PF00903 Funciton: Glyoxalase/bleomycin resistance protein/dioxygenase |
||||
PF00903 | -113 | 6.2 | ACCTCAAGTCAGCTTGAGGT | ELI_02955 |
Erythrobacter sp. NAP1 | ||||
Position: -26
Score: 6.20633 Sequence: ATCTCAAGTTAGGTTGAGGT
Locus tag: NAP1_02240
Name: PF00903 Funciton: Glyoxalase/bleomycin resistance protein/dioxygenase |
||||
PF00903 | -26 | 6.2 | ATCTCAAGTTAGGTTGAGGT | NAP1_02240 |
Novosphingobium aromaticivorans DSM 12444 | ||||
Position: -72
Score: 6.20862 Sequence: ATCTCAAGCTAACTTGAGGT
Locus tag: Saro_0953
Name: PF00903 Funciton: Glyoxalase/bleomycin resistance protein/dioxygenase
Locus tag: Saro_0952
Name: nhoA Funciton: N-hydroxyarylamine O-acetyltransferase (EC 2.3.1.118) |
||||
PF00903-nhoA | -72 | 6.2 | ATCTCAAGCTAACTTGAGGT | Saro_0953 |
Sphingopyxis alaskensis RB2256 | ||||
Position: -61
Score: 4.44719 Sequence: ATCTGAACCTCACTTCAGCT
Locus tag: Sala_2166
Name: PF00903 Funciton: Glyoxalase/bleomycin resistance protein/dioxygenase |
||||
PF00903 | -61 | 4.4 | ATCTGAACCTCACTTCAGCT | Sala_2166 |