Orthologous regulated operons containing bll2758 gene

Properties
Regulog:	FnrN/FixK/AadR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	repressor (activator)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Phylum:	Proteobacteria/Alpha

Built upon 192 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bradyrhizobium japonicum USDA 110
Position: -50 Score: 4.96349 Sequence: CGATTGAGCCAAGTCAAGGC Position: -3 Score: 4.02689 Sequence: AGCATGATCGAGGTCAGTTC Locus tag: bll2758 Name: bll2758 Funciton: Predicted transcriptional regulator, two-component, OmpR family
bll2758	-50	5	CGATTGAGCCAAGTCAAGGC	bll2758
	-3	4	AGCATGATCGAGGTCAGTTC
Bradyrhizobium sp. BTAi1
Position: -84 Score: 5.36889 Sequence: GGATTGAGCTAGATCAAGCG Locus tag: BBta_2787 Name: bll2758 Funciton: Predicted transcriptional regulator, two-component, OmpR family
bll2758	-84	5.4	GGATTGAGCTAGATCAAGCG	BBta_2787
Rhodopseudomonas palustris CGA009
Position: -92 Score: 4.83332 Sequence: GGATTGAGACAGATCAATCC Locus tag: RPA4249 Name: bll2758 Funciton: Predicted transcriptional regulator, two-component, OmpR family
bll2758	-92	4.8	GGATTGAGACAGATCAATCC	RPA4249

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --