Orthologous regulated operons containing rphyB gene
| Regulog: | FnrN/FixK/AadR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | repressor (activator) |
| Biological process: | Oxidative stress response; Nitrogen fixation |
| Effector: | Oxygen |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Rhodopseudomonas palustris CGA009 | ||||
|
Position: -119
Score: 4.22309 Sequence: CTCTTGATCTTGCGCAAAAC
Locus tag: RPA3015
Name: phyB1 Funciton: Phytochrome, two-component sensor histidine kinase (EC 2.7.3.-); Cyanobacterial phytochrome B
Locus tag: RPA3016
Name: phyB2 Funciton: Phytochrome, two-component sensor histidine kinase (EC 2.7.3.-); Cyanobacterial phytochrome B
Locus tag: RPA3017
Name: rphyB Funciton: Two-component system response regulator
Locus tag: RPA3018
Name: COG0642 Funciton: Hypothetical protein |
||||
| phyB1-phyB2-rphyB-COG0642 | -119 | 4.2 | CTCTTGATCTTGCGCAAAAC | RPA3015 |