Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing lspA gene

Properties
Regulog: CadR-PbrR - Moraxellaceae
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/gamma
Built upon 3 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Acinetobacter baumannii AB0057
Position: -61
Score: 5.24334
Sequence: ACATTATAGCTACTATATAGT
Locus tag: AB57_0301
Name: czcD2
Funciton: Co/Zn/Cd efflux protein
Locus tag: AB57_0302
Name: lspA
Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
czcD2-lspA -61 5.2 ACATTATAGCTACTATATAGT AB57_0301