Orthologous regulated operons containing czcD2 gene
| Regulog: | CadR-PbrR - Moraxellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Lead resistance; Cadmium resistance |
| Effector: | Lead ion, (Pb2+); Cadmium, ion (Cd2+) |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Acinetobacter baumannii AB0057 | ||||
|
Position: -61
Score: 5.24334 Sequence: ACATTATAGCTACTATATAGT
Locus tag: AB57_0301
Name: czcD2 Funciton: Co/Zn/Cd efflux protein
Locus tag: AB57_0302
Name: lspA Funciton: Lipoprotein signal peptidase (EC 3.4.23.36) |
||||
| czcD2-lspA | -61 | 5.2 | ACATTATAGCTACTATATAGT | AB57_0301 |