Orthologous regulated operons containing czcD2 gene

Properties
Regulog:	CadR-PbrR - Moraxellaceae
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Lead resistance; Cadmium resistance
Effector:	Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum:	Proteobacteria/gamma

Built upon 3 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Acinetobacter baumannii AB0057
Position: -61 Score: 5.24334 Sequence: ACATTATAGCTACTATATAGT Locus tag: AB57_0301 Name: czcD2 Funciton: Co/Zn/Cd efflux protein Locus tag: AB57_0302 Name: lspA Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
czcD2-lspA	-61	5.2	ACATTATAGCTACTATATAGT	AB57_0301

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --