Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing merA gene

Properties
Regulog: MerR - Xanthomonadales
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Mercury resistance
Effector: Mercury ion, (Hg2+)
Phylum: Proteobacteria/gamma
Built upon 1 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Stenotrophomonas maltophilia K279a
Position: -66
Score: 6.35688
Sequence: ACTCCGTACTTGACTACGGAAG
Locus tag: Smlt2410
Name: merT
Funciton: Mercury uptake inner membane protein
Locus tag: Smlt2411
Name: merP
Funciton: Periplasmic mercury(+2) binding protein
Locus tag: Smlt2412
Name: merA
Funciton: Mercuric ion reductase (EC 1.16.1.1)
merT-merP-merA -66 6.4 ACTCCGTACTTGACTACGGAAG Smlt2410