Orthologous regulated operons containing RSal33209_2682 gene

Properties
Regulog:	PaaR - Micrococcineae
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Phylum:	Actinobacteria

Built upon 38 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Renibacterium salmoninarum ATCC 33209
Position: -91 Score: 4.8245 Sequence: AATTACTGACCACTCGTTCAGT Locus tag: RSal33209_2682 Name: null Funciton: 2-hydroxyphenylacetyl-CoA ring opening enzyme Locus tag: RSal33209_2681 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ Locus tag: RSal33209_2680 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
RSal33209_2682-paaZ-paaZ	-91	4.8	AATTACTGACCACTCGTTCAGT	RSal33209_2682

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --