Orthologous regulated operons containing csbA gene

Properties
Regulog:	CzrA - Listeriaceae
Regulator type:	Transcription factor
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Zinc resistance; Nickel resistance; Copper resistance; Cobalt resistance; Cadmium resistance
Effector:	Zinc ion, (Zn2+); Silver ion, (Ag+); Nickel ion, (Ni2+); Copper ion, (Cu2+); Cobalt ion, (Co2+); Cadmium, ion (Cd2+)
Phylum:	Firmicutes

Built upon 4 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Listeria innocua Clip11262
Position: -42 Score: 6.52468 Sequence: CATATGAATATATGACCATATA Locus tag: lin2636 Name: czrA Funciton: Transcriptional repressor of multiple metal-sensing, ArsR family Locus tag: lin2635 Name: null Funciton: Hypothetical protein Locus tag: lin2634 Name: czcD Funciton: Cation efflux transporter Locus tag: lin2633 Name: csbA Funciton: Hypothetical protein
czrA-lin2635-czcD-csbA	-42	6.5	CATATGAATATATGACCATATA	lin2636
Listeria monocytogenes EGD-e
Position: -43 Score: 6.83625 Sequence: CATATGAGTATATGAACATATA Locus tag: lmo2493 Name: czrA Funciton: Transcriptional repressor of multiple metal-sensing, ArsR family Locus tag: lmo2492 Name: null Funciton: Hypothetical protein Locus tag: lmo2491 Name: czcD Funciton: Cation efflux transporter Locus tag: lmo2490 Name: csbA Funciton: Hypothetical protein
czrA-lmo2492-czcD-csbA	-43	6.8	CATATGAGTATATGAACATATA	lmo2493
Listeria seeligeri serovar 1/2b str. SLCC3954
Position: -43 Score: 6.54304 Sequence: CATATGAGTATATGAACATGTA Locus tag: lse_2393 Name: czrA Funciton: Transcriptional repressor of multiple metal-sensing, ArsR family Locus tag: lse_2392 Name: null Funciton: Hypothetical protein Locus tag: lse_2391 Name: czcD Funciton: Cation efflux transporter Locus tag: lse_2390 Name: csbA Funciton: Hypothetical protein
czrA-lse_2392-czcD-csbA	-43	6.5	CATATGAGTATATGAACATGTA	lse_2393
Listeria welshimeri serovar 6b str. SLCC5334
Position: -43 Score: 6.83625 Sequence: CATATGAGTATATGAACATATA Locus tag: lwe2441 Name: czrA Funciton: Transcriptional repressor of multiple metal-sensing, ArsR family Locus tag: lwe2440 Name: null Funciton: Hypothetical protein Locus tag: lwe2439 Name: czcD Funciton: Cation efflux transporter Locus tag: lwe2438 Name: csbA Funciton: Hypothetical protein
czrA-lwe2440-czcD-csbA	-43	6.8	CATATGAGTATATGAACATATA	lwe2441