Orthologous regulated operons containing nosF gene
| Regulog: | FnrN/FixK/AadR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | repressor (activator) |
| Biological process: | Oxidative stress response; Nitrogen fixation |
| Effector: | Oxygen |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bradyrhizobium sp. BTAi1 | ||||
|
Position: -182
Score: 4.73085 Sequence: TGTTTGATCCAGCGCAACGT
Locus tag: BBta_6007
Name: nosR Funciton: Nitrous oxide reductase maturation protein NosR
Locus tag: BBta_6008
Name: nosZ Funciton: Nitrous-oxide reductase (EC 1.7.99.6)
Locus tag: BBta_6009
Name: nosD Funciton: Nitrous oxide reductase maturation protein NosD
Locus tag: BBta_6010
Name: nosF Funciton: Nitrous oxide reductase maturation protein NosF (ATPase)
Locus tag: BBta_6011
Name: nosY Funciton: Nitrous oxide reductase maturation transmembrane protein NosY
Locus tag: BBta_6012
Name: nosL Funciton: Nitrous oxide reductase maturation protein, outer-membrane lipoprotein NosL
Locus tag: BBta_6013
Name: nosX Funciton: Nitrous oxide reductase maturation periplasmic protein NosX |
||||
| nosR-nosZ-nosD-nosF-nosY-nosL-nosX | -182 | 4.7 | TGTTTGATCCAGCGCAACGT | BBta_6007 |
| Sinorhizobium meliloti 1021 | ||||
|
Position: -83
Score: 4.68456 Sequence: AAGTTGATCTGGCGCAAAGA
Locus tag: SMa1179
Name: nosR Funciton: Nitrous oxide reductase maturation protein NosR
Locus tag: SMa1182
Name: nosZ Funciton: Nitrous-oxide reductase (EC 1.7.99.6)
Locus tag: SMa1183
Name: nosD Funciton: Nitrous oxide reductase maturation protein NosD
Locus tag: SMa1184
Name: nosF Funciton: Nitrous oxide reductase maturation protein NosF (ATPase)
Locus tag: SMa1185
Name: nosY Funciton: Nitrous oxide reductase maturation transmembrane protein NosY
Locus tag: SMa1186
Name: nosL Funciton: Nitrous oxide reductase maturation protein, outer-membrane lipoprotein NosL
Locus tag: SMa1188
Name: nosX Funciton: Nitrous oxide reductase maturation periplasmic protein NosX |
||||
| nosR-nosZ-nosD-nosF-nosY-nosL-nosX | -83 | 4.7 | AAGTTGATCTGGCGCAAAGA | SMa1179 |