Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing nosR gene

Properties
Regulog: FnrN/FixK/AadR - Rhizobiales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: repressor (activator)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Phylum: Proteobacteria/Alpha
Built upon 192 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bradyrhizobium japonicum USDA 110
Position: -134
Score: 4.88302
Sequence: AGCTTGATCCAGCGCAAACA
Locus tag: blr0314
Name: nosR
Funciton: Nitrous oxide reductase maturation protein NosR
nosR -134 4.9 AGCTTGATCCAGCGCAAACA blr0314
Bradyrhizobium sp. BTAi1
Position: -182
Score: 4.73085
Sequence: TGTTTGATCCAGCGCAACGT
Locus tag: BBta_6007
Name: nosR
Funciton: Nitrous oxide reductase maturation protein NosR
Locus tag: BBta_6008
Name: nosZ
Funciton: Nitrous-oxide reductase (EC 1.7.99.6)
Locus tag: BBta_6009
Name: nosD
Funciton: Nitrous oxide reductase maturation protein NosD
Locus tag: BBta_6010
Name: nosF
Funciton: Nitrous oxide reductase maturation protein NosF (ATPase)
Locus tag: BBta_6011
Name: nosY
Funciton: Nitrous oxide reductase maturation transmembrane protein NosY
Locus tag: BBta_6012
Name: nosL
Funciton: Nitrous oxide reductase maturation protein, outer-membrane lipoprotein NosL
Locus tag: BBta_6013
Name: nosX
Funciton: Nitrous oxide reductase maturation periplasmic protein NosX
nosR-nosZ-nosD-nosF-nosY-nosL-nosX -182 4.7 TGTTTGATCCAGCGCAACGT BBta_6007
Sinorhizobium meliloti 1021
Position: -83
Score: 4.68456
Sequence: AAGTTGATCTGGCGCAAAGA
Locus tag: SMa1179
Name: nosR
Funciton: Nitrous oxide reductase maturation protein NosR
Locus tag: SMa1182
Name: nosZ
Funciton: Nitrous-oxide reductase (EC 1.7.99.6)
Locus tag: SMa1183
Name: nosD
Funciton: Nitrous oxide reductase maturation protein NosD
Locus tag: SMa1184
Name: nosF
Funciton: Nitrous oxide reductase maturation protein NosF (ATPase)
Locus tag: SMa1185
Name: nosY
Funciton: Nitrous oxide reductase maturation transmembrane protein NosY
Locus tag: SMa1186
Name: nosL
Funciton: Nitrous oxide reductase maturation protein, outer-membrane lipoprotein NosL
Locus tag: SMa1188
Name: nosX
Funciton: Nitrous oxide reductase maturation periplasmic protein NosX
nosR-nosZ-nosD-nosF-nosY-nosL-nosX -83 4.7 AAGTTGATCTGGCGCAAAGA SMa1179