Orthologous regulated operons containing napF gene

Properties
Regulog:	FnrN/FixK/AadR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	repressor (activator)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Phylum:	Proteobacteria/Alpha

Built upon 192 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Rhizobium sp. NGR234
Position: -130 Score: 4.73977 Sequence: TAATTGACGAAAATCAATTT Locus tag: NGR_c09990 Name: napE Funciton: Periplasmic nitrate reductase component NapE Locus tag: NGR_c10000 Name: napF Funciton: Periplasmic nitrate reductase, ferredoxin-type protein NapF Locus tag: NGR_c10010 Name: napD Funciton: Periplasmic nitrate reductase component NapD Locus tag: NGR_c10020 Name: napA Funciton: Periplasmic nitrate reductase precursor (EC 1.7.99.4) Locus tag: NGR_c10030 Name: napB Funciton: Nitrate reductase cytochrome c550-type subunit Locus tag: NGR_c10040 Name: napC Funciton: Cytochrome c-type protein NapC
napE-napF-napD-napA-napB-napC	-130	4.7	TAATTGACGAAAATCAATTT	NGR_c09990
Sinorhizobium meliloti 1021
Position: -131 Score: 4.73977 Sequence: TAATTGACGGAAATCAATTT Locus tag: SMa1241 Name: napE Funciton: Periplasmic nitrate reductase component NapE Locus tag: SMa1240 Name: napF Funciton: Periplasmic nitrate reductase, ferredoxin-type protein NapF Locus tag: SMa1239 Name: napD Funciton: Periplasmic nitrate reductase component NapD Locus tag: SMa1236 Name: napA Funciton: Periplasmic nitrate reductase precursor (EC 1.7.99.4) Locus tag: SMa1233 Name: napB Funciton: Nitrate reductase cytochrome c550-type subunit Locus tag: SMa1232 Name: napC Funciton: Cytochrome c-type protein NapC
napE-napF-napD-napA-napB-napC	-131	4.7	TAATTGACGGAAATCAATTT	SMa1241

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --