Orthologous regulated operons containing napE gene
| Regulog: | FnrN/FixK/AadR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | repressor (activator) |
| Biological process: | Oxidative stress response; Nitrogen fixation |
| Effector: | Oxygen |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bradyrhizobium japonicum USDA 110 | ||||
|
Position: -104
Score: 5.48817 Sequence: GGATTGATCCAGATCAACGC
Locus tag: bsr7036
Name: napE Funciton: Periplasmic nitrate reductase component NapE
Locus tag: blr7037
Name: napD Funciton: Periplasmic nitrate reductase component NapD
Locus tag: blr7038
Name: napA Funciton: Periplasmic nitrate reductase precursor (EC 1.7.99.4)
Locus tag: blr7039
Name: napB Funciton: Nitrate reductase cytochrome c550-type subunit
Locus tag: blr7040
Name: napC Funciton: Cytochrome c-type protein NapC |
||||
| napE-napD-napA-napB-napC | -104 | 5.5 | GGATTGATCCAGATCAACGC | bsr7036 |
| Bradyrhizobium sp. BTAi1 | ||||
|
Position: -103
Score: 5.19286 Sequence: GCCTTGATCCACGTCAACGC
Locus tag: BBta_1864
Name: napE Funciton: Periplasmic nitrate reductase component NapE
Locus tag: BBta_1863
Name: napD Funciton: Periplasmic nitrate reductase component NapD
Locus tag: BBta_1862
Name: napA Funciton: Periplasmic nitrate reductase precursor (EC 1.7.99.4)
Locus tag: BBta_1861
Name: napB Funciton: Nitrate reductase cytochrome c550-type subunit
Locus tag: BBta_1860
Name: napC Funciton: Cytochrome c-type protein NapC |
||||
| napE-napD-napA-napB-napC | -103 | 5.2 | GCCTTGATCCACGTCAACGC | BBta_1864 |
| Rhizobium sp. NGR234 | ||||
|
Position: -130
Score: 4.73977 Sequence: TAATTGACGAAAATCAATTT
Locus tag: NGR_c09990
Name: napE Funciton: Periplasmic nitrate reductase component NapE
Locus tag: NGR_c10000
Name: napF Funciton: Periplasmic nitrate reductase, ferredoxin-type protein NapF
Locus tag: NGR_c10010
Name: napD Funciton: Periplasmic nitrate reductase component NapD
Locus tag: NGR_c10020
Name: napA Funciton: Periplasmic nitrate reductase precursor (EC 1.7.99.4)
Locus tag: NGR_c10030
Name: napB Funciton: Nitrate reductase cytochrome c550-type subunit
Locus tag: NGR_c10040
Name: napC Funciton: Cytochrome c-type protein NapC |
||||
| napE-napF-napD-napA-napB-napC | -130 | 4.7 | TAATTGACGAAAATCAATTT | NGR_c09990 |
| Sinorhizobium meliloti 1021 | ||||
|
Position: -131
Score: 4.73977 Sequence: TAATTGACGGAAATCAATTT
Locus tag: SMa1241
Name: napE Funciton: Periplasmic nitrate reductase component NapE
Locus tag: SMa1240
Name: napF Funciton: Periplasmic nitrate reductase, ferredoxin-type protein NapF
Locus tag: SMa1239
Name: napD Funciton: Periplasmic nitrate reductase component NapD
Locus tag: SMa1236
Name: napA Funciton: Periplasmic nitrate reductase precursor (EC 1.7.99.4)
Locus tag: SMa1233
Name: napB Funciton: Nitrate reductase cytochrome c550-type subunit
Locus tag: SMa1232
Name: napC Funciton: Cytochrome c-type protein NapC |
||||
| napE-napF-napD-napA-napB-napC | -131 | 4.7 | TAATTGACGGAAATCAATTT | SMa1241 |