Orthologous regulated operons containing blr3521 gene

Properties
Regulog:	FnrN/FixK/AadR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	repressor (activator)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Phylum:	Proteobacteria/Alpha

Built upon 192 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bradyrhizobium japonicum USDA 110
Position: -76 Score: 4.58898 Sequence: GCCTTGATTTGGCTCATACG Locus tag: blr3521 Name: null Funciton: Lipocalin-related protein and Bos/Can/Equ allergen
blr3521	-76	4.6	GCCTTGATTTGGCTCATACG	blr3521
Rhodopseudomonas palustris CGA009
Position: -107 Score: 4.69361 Sequence: CGGTTGCGCCAGATCAATGT Locus tag: RPA4462 Name: null Funciton: Lipocalin-related protein and Bos/Can/Equ allergen
RPA4462	-107	4.7	CGGTTGCGCCAGATCAATGT	RPA4462

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --