Orthologous regulated operons containing bchI gene
| Regulog: | FnrN/FixK/AadR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | repressor (activator) |
| Biological process: | Oxidative stress response; Nitrogen fixation |
| Effector: | Oxygen |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Rhodopseudomonas palustris CGA009 | ||||
|
Position: -243
Score: 4.51042 Sequence: CTTTTGACCTTGCTCAATAT
Position: -143
Score: 4.42536 Sequence: GAATTGTCCGAGATCAACGA
Locus tag: RPA1505
Name: hemC Funciton: Porphobilinogen deaminase (EC 2.5.1.61)
Locus tag: RPA1506
Name: bchI Funciton: Protoporphyrin IX Mg-chelatase subunit I (EC 6.6.1.1)
Locus tag: RPA1507
Name: bchD Funciton: Protoporphyrin IX Mg-chelatase subunit D (EC 6.6.1.1) |
||||
| hemC-bchI-bchD | -243 | 4.5 | CTTTTGACCTTGCTCAATAT | RPA1505 |
| -143 | 4.4 | GAATTGTCCGAGATCAACGA | ||