Orthologous regulated operons containing mhpA gene
| Regulog: | FnrN/FixK/AadR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | repressor (activator) |
| Biological process: | Oxidative stress response; Nitrogen fixation |
| Effector: | Oxygen |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bradyrhizobium sp. BTAi1 | ||||
|
Position: -52
Score: 5.75838 Sequence: CCTTTGATCCAGATCAAGCG
Locus tag: BBta_2733
Name: mhpA Funciton: Protocatechuate 4,5-dioxygenase alpha chain (EC 1.13.11.8)
Locus tag: BBta_2734
Name: mhpB Funciton: Protocatechuate 4,5-dioxygenase beta chain (EC 1.13.11.8) |
||||
| mhpA-mhpB | -52 | 5.8 | CCTTTGATCCAGATCAAGCG | BBta_2733 |
| Rhodopseudomonas palustris CGA009 | ||||
|
Position: -69
Score: 4.87993 Sequence: TATTTGACGCACGTCAAATA
Locus tag: RPA1006
Name: mhpA Funciton: Protocatechuate 4,5-dioxygenase alpha chain (EC 1.13.11.8)
Locus tag: RPA1007
Name: mhpB Funciton: Protocatechuate 4,5-dioxygenase beta chain (EC 1.13.11.8) |
||||
| mhpA-mhpB | -69 | 4.9 | TATTTGACGCACGTCAAATA | RPA1006 |