Orthologous regulated operons containing mtrA gene
| Regulog: | FnrN/FixK/AadR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | repressor (activator) |
| Biological process: | Oxidative stress response; Nitrogen fixation |
| Effector: | Oxygen |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Rhodopseudomonas palustris CGA009 | ||||
|
Position: -234
Score: 5.35366 Sequence: TAATTGATCTCGATCAAATA
Locus tag: RPA0746
Name: mtrA Funciton: Decaheme cytochrome c MtrA |
||||
| mtrA | -234 | 5.4 | TAATTGATCTCGATCAAATA | RPA0746 |