Orthologous regulated operons containing badD gene

Properties
Regulog:	FnrN/FixK/AadR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	repressor (activator)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Phylum:	Proteobacteria/Alpha

Built upon 192 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Rhodopseudomonas palustris CGA009
Position: -120 Score: 5.37562 Sequence: AATTTGATCCGCATCAAATT Locus tag: RPA0657 Name: badD Funciton: Benzoyl-CoA reductase subunit BadD (EC 1.3.99.15) Locus tag: RPA0658 Name: badE Funciton: Benzoyl-CoA reductase subunit BadE (EC 1.3.99.15) Locus tag: RPA0659 Name: badF Funciton: Benzoyl-CoA reductase subunit BadF (EC 1.3.99.15) Locus tag: RPA0660 Name: badG Funciton: Benzoyl-CoA reductase subunit BadG (EC 1.3.99.15) Locus tag: RPA0661 Name: badA Funciton: Benzoate-CoA ligase (EC 6.2.1.25)
badD-badE-badF-badG-badA	-120	5.4	AATTTGATCCGCATCAAATT	RPA0657

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --