Orthologous regulated operons containing BBta_5758 gene

Properties
Regulog:	FnrN/FixK/AadR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	repressor (activator)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Phylum:	Proteobacteria/Alpha

Built upon 192 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bradyrhizobium sp. BTAi1
Position: -109 Score: 5.27933 Sequence: GAATTGACCCAGGTCAAAGG Position: -75 Score: 5.11281 Sequence: TCATTGATGCAGCTCAAGGC Locus tag: BBta_5758 Name: null Funciton: hypothetical protein Locus tag: BBta_5757 Name: null Funciton: Polyhydroxyalkanoic acid synthase
BBta_5758-BBta_5757	-109	5.3	GAATTGACCCAGGTCAAAGG	BBta_5758
	-75	5.1	TCATTGATGCAGCTCAAGGC

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --