Orthologous regulated operons containing phbC gene
| Regulog: | FnrN/FixK/AadR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | repressor (activator) |
| Biological process: | Oxidative stress response; Nitrogen fixation |
| Effector: | Oxygen |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bradyrhizobium japonicum USDA 110 | ||||
|
Position: -149
Score: 5.19493 Sequence: GGTTTGACTCAGGTCAAGCG
Position: -84
Score: 4.71877 Sequence: GATTTGATGCAGCTCAACAC
Locus tag: bll6073
Name: phbC Funciton: Polyhydroxyalkanoic acid synthase |
||||
| phbC | -149 | 5.2 | GGTTTGACTCAGGTCAAGCG | bll6073 |
| -84 | 4.7 | GATTTGATGCAGCTCAACAC | ||
| Bradyrhizobium sp. BTAi1 | ||||
|
Position: -109
Score: 5.27933 Sequence: GAATTGACCCAGGTCAAAGG
Position: -75
Score: 5.11281 Sequence: TCATTGATGCAGCTCAAGGC
Locus tag: BBta_5758
Name: null Funciton: hypothetical protein
Locus tag: BBta_5757
Name: null Funciton: Polyhydroxyalkanoic acid synthase |
||||
| BBta_5758-BBta_5757 | -109 | 5.3 | GAATTGACCCAGGTCAAAGG | BBta_5758 |
| -75 | 5.1 | TCATTGATGCAGCTCAAGGC | ||
| Rhodopseudomonas palustris CGA009 | ||||
|
Position: -235
Score: 5.01737 Sequence: GGCTTGAGCAAGGTCAAGCG
Locus tag: RPA4243
Name: phaC Funciton: Polyhydroxyalkanoic acid synthase |
||||
| phaC | -235 | 5 | GGCTTGAGCAAGGTCAAGCG | RPA4243 |