Orthologous regulated operons containing adhP gene
| Regulog: | FnrN/FixK/AadR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | repressor (activator) |
| Biological process: | Oxidative stress response; Nitrogen fixation |
| Effector: | Oxygen |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bradyrhizobium japonicum USDA 110 | ||||
|
Position: -81
Score: 4.73571 Sequence: GCATTGAGGGAGGTCAAGGA
Locus tag: blr6070
Name: adhP Funciton: Predicted alcohol dehydrogenase (EC 1.1.1.1), zinc containing
Locus tag: blr6071
Name: COG2187 Funciton: Predicted kinase |
||||
| adhP-COG2187 | -81 | 4.7 | GCATTGAGGGAGGTCAAGGA | blr6070 |
| Bradyrhizobium sp. BTAi1 | ||||
|
Position: -75
Score: 4.76686 Sequence: ACCTTGACAGACATCAAGCC
Locus tag: BBta_5755
Name: adhP Funciton: Predicted alcohol dehydrogenase (EC 1.1.1.1), zinc containing
Locus tag: BBta_5756
Name: COG2187 Funciton: Predicted kinase |
||||
| adhP-COG2187 | -75 | 4.8 | ACCTTGACAGACATCAAGCC | BBta_5755 |