Orthologous regulated operons containing attK gene
| Regulog: | FnrN/FixK/AadR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | repressor (activator) |
| Biological process: | Oxidative stress response; Nitrogen fixation |
| Effector: | Oxygen |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bradyrhizobium japonicum USDA 110 | ||||
|
Position: -123
Score: 4.77614 Sequence: CGATTGACCTGTCTCAAAGT
Locus tag: bll3998
Name: attK Funciton: Succinate-semialdehyde dehydrogenase [NAD] (EC 1.2.1.24); Succinate-semialdehyde dehydrogenase [NADP+] (EC 1.2.1.16) |
||||
| attK | -123 | 4.8 | CGATTGACCTGTCTCAAAGT | bll3998 |